gG.RdWrapper that instantiates a gGraph object from a variety of different inputs.
Only select parameters combos need to be / should be specified simultaneously.
gG(
genome = NULL,
breaks = NULL,
junctions = NULL,
alignments = NULL,
juncs = NULL,
prego = NULL,
jabba = NULL,
cougar = NULL,
weaver = NULL,
remixt = NULL,
rck = NULL,
nodes = NULL,
edges = NULL,
walks = NULL,
nodeObj = NULL,
edgeObj = NULL,
meta = NULL
)seqlengths or seqinfo object around which to build an empty gGraph
GRanges around which to build a reference gGraph
BND vcf or bedpe file path, gGraph::Junctions object, or GRangesList specifying pairs of locations to reconnect (can be used in conjunction with breaks)
GRanges with fields $cigar $flag and $qname (e.g. output of bamUtils::read.bam or RSeqLib::BWA specifying alignments to a reference, the graph will then represent the (possibly multimapped) implicit nodes and edges representing an "end to end" walk of all queries lifted to the reference. Insertions are represented as 0-width nodes and multi-maps yield branches. The resulting graph can be walked to exhaustively or greedily enumerate all possible linear embeddings of the queries on the reference
path to PREGO output file. if specified, instantiates a gGraph object from PREGO output with y.field "cn" specifying copy number
path to JaBbA .rds output file, if specified instantiates a gGraph object from JaBbA output with y.field "cn" specifying copy number
path to Weaver output. if specified, instantiates a gGraph object from Weaver output with y.field "cn" specifying copy number
path to RemiXT output, if specified, instantiates a gGraph object from ReMiXT output with y.field "cn" specifying copy number
path to RCK output, if specified, instantiates a gGraph object from RCK output with y.field "cn" specifying total copy number
GRanges of unsigned intervals to be rejoined in gGRaph, used in conjunction with edges argument below
data.table with field n1, n2, n1.side, n2.side with each row specifying an edge, i.e. which sides ("left" vs "right") of which integer node indices to connect in the gGRaph
GRangesList or gWalk to build a "haplograph" around, see ?haplograph
gNode object to create a gGraph around (similar to nodes input above), except generated via the $nodes accessor of an existing gGraph object, used in cojunction with gEdge input to create a new gGnome object from an existing one
list of metadata to associate with this gGraph object, for now mostly used to populate gTrack visualization parameters
gEdge object to create a gGraph around (similar to edges input above), except generated via the $edges accessor of an existing gGraph object
A new gGraph object that is the sum of the component gGraphs
mygenome = c('chr1' = 1e6, 'chr2' = 1e7)
myjuncs = system.file('extdata', "delly.final.vcf.gz", package = "gGnome") ## junctions
mybreaks = gr.tile(mygenome, 10000) ## 1kb tiles across my genome
myweaver = system.file('extdata', 'weaver', package='gGnome')
myremixt = system.file('extdata', 'remixt', package='gGnome')
myprego = system.file('extdata', 'intervalFile.results', package='gGnome')
myjab = system.file('extdata', 'jabba.simple.rds', package="gGnome")
gG(genome = mygenome)
#> gGraph with 0 nodes, 0 loose ends (0 terminal and 0 internal), and 0 edges (0 REF and 0 ALT)
#>
#> gNode object of length 0
## create a graph from junctions
gG(breaks = mybreaks, juncs = myjuncs)
#> gGraph with 1435 nodes, 146 loose ends (146 terminal and 0 internal), and 1470 edges (1206 REF and 264 ALT)
#> comprising:
#> gNode object of length 1435
#> GRanges object with 4 ranges and 7 metadata columns:
#> seqnames ranges strand | query.id tile.id loose.left
#> <Rle> <IRanges> <Rle> | <integer> <integer> <logical>
#> 1 1 6525379 + | <NA> <NA> TRUE
#> 2 1 6569298-6683445 + | <NA> <NA> FALSE
#> 3 1 6683446 + | <NA> <NA> FALSE
#> 4 1 6683447-8397762 + | <NA> <NA> FALSE
#> loose.right node.id snode.id index
#> <logical> <integer> <numeric> <integer>
#> 1 FALSE 1 1 1
#> 2 FALSE 2 2 2
#> 3 FALSE 3 3 3
#> 4 FALSE 4 4 4
#> -------
#> seqinfo: 86 sequences from an unspecified genome
#> ... (1431 additional nodes)
#>
#> gEdge object with 1470 edges
#> sedge.id type grl.ix CIEND CIPOS CHR2 END PE MAPQ SR SRQ
#> 1: 1 ALT 1 -4, 4 -4, 4 1 58605870 11 37 10 1.000000
#> 2: 2 ALT 2 -165, 165 -165, 165 2 92322345 15 25 NA NA
#> 3: 3 ALT 3 -5, 5 -5, 5 2 136132774 23 37 10 0.975610
#> 4: 4 ALT 4 -2, 2 -2, 2 2 143640816 15 37 9 0.977099
#> CONSENSUS
#> 1: CTGTCATAGGGTCTTATAGTCATTTGCTTAACTGTCTGAATCCCATCTTCATCTCTAAGCTCCTTGGATGCTACTTGAGGCTCAATAGAAGAATGATACTTTCTAGCTTCACCATGTGGTATGGAATATGGTTCAGCCATCACAA
#> 2: <NA>
#> 3: CTTGATATTTGCAAGTTGGTGCTCAGAATTCATACTTTAGGACAGGAGGCTCTGGAGTGGTGGCCCATAGTGTGATCTCTTGGACCTGAAGAATGTATTGAAGGAGGATTATTTTTTAGGTAGACTTGAGAAAAATATGAGACACAGAAGGAAAGGAATTAATC
#> 4: AGTTTGCCAGGCTAGTTTCCACTTGAATCTTCAGATCTTTCTTCCTTCATTGTCTTGTTAACTGTCCAGATTTATTACCTAGGAGTTTATTACCAGTGGTGCAACCTCGGCTCACTGCAGGCTCCACCCC
#> CE CT IMPRECISE PRECISE SVTYPE SVMETHOD INSLEN HOMLEN
#> 1: 1.96437 3to5 FALSE TRUE DEL EMBL.DELLYv0.7.7 0 3
#> 2: NA 3to5 TRUE FALSE DEL EMBL.DELLYv0.7.7 NA NA
#> 3: 1.92497 3to5 FALSE TRUE DEL EMBL.DELLYv0.7.7 0 5
#> 4: 1.94283 3to5 FALSE TRUE DEL EMBL.DELLYv0.7.7 0 1
#> RDRATIO SOMATIC paramRangeID REF ALT QUAL FILTER edge.id class n1.side
#> 1: 0.684033 TRUE <NA> G <DEL> NA PASS 1 DEL-like right
#> 2: 1.031910 TRUE <NA> A <DEL> NA PASS 2 DEL-like right
#> 3: 0.327684 TRUE <NA> C <DEL> NA PASS 3 DEL-like right
#> 4: 0.653066 TRUE <NA> A <DEL> NA PASS 4 DEL-like right
#> n2.side n1 n2
#> 1: left 10 11
#> 2: left 186 187
#> 3: left 189 190
#> 4: left 190 191
#> ... (1466 additional edges)
## import a genome graph from popular callers
gG(jabba = myjab)
#> gGraph with 895 nodes, 448 loose ends (170 terminal and 278 internal), and 1079 edges (810 REF and 269 ALT)
#> comprising:
#> gNode object of length 895
#> GRanges object with 4 ranges and 16 metadata columns:
#> seqnames ranges strand | cn start.ix end.ix eslack.in
#> <Rle> <IRanges> <Rle> | <numeric> <integer> <integer> <numeric>
#> 1 1 1-6525379 + | 4 1 73 0
#> 2 1 6525380-6569292 + | 2 74 76 0
#> 3 1 6569293-6570681 + | 3 77 78 0
#> 4 1 6570682-6570788 + | 4 79 79 0
#> eslack.out loose edges.in edges.out tile.id index
#> <numeric> <logical> <character> <character> <integer> <integer>
#> 1 0 FALSE ()-> ->2(2),->129(2) 1 1
#> 2 0 FALSE 1(2)-> ->3(2) 2 2
#> 3 0 FALSE 2(2)->,899(1)-> ->4(3) 3 3
#> 4 0 FALSE 3(3)->,898(1)-> ->5(3),->814(1) 4 4
#> snode.id loose.left loose.right loose.cn.left loose.cn.right node.id
#> <numeric> <logical> <logical> <numeric> <numeric> <integer>
#> 1 1 TRUE FALSE 0 0 1
#> 2 2 FALSE FALSE 0 0 2
#> 3 3 FALSE FALSE 0 0 3
#> 4 4 FALSE FALSE 0 0 4
#> -------
#> seqinfo: 85 sequences from an unspecified genome
#> ... (891 additional nodes)
#>
#> gEdge object with 1079 edges
#> sedge.id cn type CHROM POS paramRangeID REF ALT QUAL FILTER
#> 1: 1 2 REF <NA> NA <NA> <NA> NA <NA>
#> 2: 2 2 ALT 1 6525379 <NA> C C[3:85232671[ 99 PASS
#> 3: 3 2 REF <NA> NA <NA> <NA> NA <NA>
#> 4: 4 3 REF <NA> NA <NA> <NA> NA <NA>
#> DISC_MAPQ NUMPARTS MATEMAPQ MATEID MAPQ REPSEQ READNAMES
#> 1: NA NA NA <NA> NA <NA>
#> 2: 255 3 NA 6536:2 60 <NA>
#> 3: NA NA NA <NA> NA <NA>
#> 4: NA NA NA <NA> NA <NA>
#> SCTG SVTYPE BX NM MATENM SPAN
#> 1: <NA> <NA> NA NA NA
#> 2: c_1_6517001_6542001_163C BND 0 0 -1
#> 3: <NA> <NA> NA NA NA
#> 4: <NA> <NA> NA NA NA
#> INSERTION
#> 1: <NA>
#> 2: ATAGAGCCCAAACCCAATTAATCTTCTAAAAATGGGTAGCCTCTCTTTGACAGCACAGTGCAATTGCATGGTTTTGGAAGCTGAGAGAAAATATTCTATCATGTCTATATTCTTTTGGCCTCTAACATGTATTAAAATTGATATTATTTTAATGATTTCTCAATATTTTGAATCTCTATACATTGAAAGTTTAAAACAATATAAT
#> 3: <NA>
#> 4: <NA>
#> SUBN HOMLEN HOMSEQ IMPRECISE EVDNC SECONDARY mateid svtype first right
#> 1: NA NA <NA> NA <NA> NA <NA> <NA> NA NA
#> 2: NA NA <NA> FALSE TSI_G FALSE 6536:2 BND TRUE TRUE
#> 3: NA NA <NA> NA <NA> NA <NA> <NA> NA NA
#> 4: NA NA <NA> NA <NA> NA <NA> <NA> NA NA
#> coord mcoord mix MATECHROM MATEPOS tier edge.id class n1.side
#> 1: <NA> <NA> NA <NA> NA NA 1 REF right
#> 2: 1:6525379 3:85232671 122 3 85232670 2 2 TRA-like right
#> 3: <NA> <NA> NA <NA> NA NA 3 REF right
#> 4: <NA> <NA> NA <NA> NA NA 4 REF right
#> n2.side n1 n2
#> 1: left 1 2
#> 2: left 1 129
#> 3: left 2 3
#> 4: left 3 4
#> ... (1075 additional edges)
gG(weaver = myweaver)
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 2 out-of-bound ranges located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 2 out-of-bound ranges located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 2 out-of-bound ranges located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 2 out-of-bound ranges located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 2 out-of-bound ranges located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> Warning: GRanges object contains 1 out-of-bound range located on sequence 17.
#> Note that ranges located on a sequence whose length is unknown (NA) or
#> on a circular sequence are not considered out-of-bound (use
#> seqlengths() and isCircular() to get the lengths and circularity flags
#> of the underlying sequences). You can use trim() to trim these ranges.
#> See ?`trim,GenomicRanges-method` for more information.
#> gGraph with 7124 nodes, 6382 loose ends (46 terminal and 6336 internal), and 7427 edges (7101 REF and 326 ALT)
#> comprising:
#> gNode object of length 7124
#> GRanges object with 4 ranges and 8 metadata columns:
#> seqnames ranges strand | acn bcn cn loose.left
#> <Rle> <IRanges> <Rle> | <integer> <integer> <integer> <logical>
#> 1 1 1-10000 + | <NA> <NA> <NA> TRUE
#> 2 1 10001-11000 + | 15 0 15 TRUE
#> 3 1 11001-564368 + | 9 0 9 FALSE
#> 4 1 564369-565368 + | 155 0 155 TRUE
#> loose.right node.id snode.id index
#> <logical> <integer> <numeric> <integer>
#> 1 FALSE 1 1 1
#> 2 TRUE 2 2 2
#> 3 FALSE 3 3 3
#> 4 TRUE 4 4 4
#> -------
#> seqinfo: 23 sequences from an unspecified genome
#> ... (7120 additional nodes)
#>
#> gEdge object with 7427 edges
#> sedge.id type grl.ix allele1 allele2 cn unknown1 unknown2
#> 1: 1 ALT 1 -1 -1 1 3 10/0
#> 2: 2 ALT 2 -1 -1 9 3 4/3
#> 3: 3 ALT 3 1 1 5 3 22/10
#> 4: 4 ALT 4 -1 -1 3 3 10/0
#> timing class edge.id n1.side n2.side n1 n2
#> 1: somatic_post_aneuploid DUP-like 1 left right 14 24
#> 2: somatic_post_aneuploid DEL-like 2 right left 14 26
#> 3: somatic_post_aneuploid TRA-like 3 right right 57 4531
#> 4: somatic_post_aneuploid INV-like 4 left left 60 62
#> ... (7423 additional edges)
gG(prego = myprego)
#> gGraph with 604 nodes, 54 loose ends (54 terminal and 0 internal), and 690 edges (576 REF and 114 ALT)
#> comprising:
#> gNode object of length 604
#> GRanges object with 4 ranges and 8 metadata columns:
#> seqnames ranges strand | cn left.tag right.tag
#> <Rle> <IRanges> <Rle> | <integer> <character> <character>
#> 1 1 1-6525379 + | 2 c1_1_1 c1_1_6525379
#> 2 1 6525380-6570788 + | 2 c2_1_6525380 c2_1_6570788
#> 3 1 6570789-8175806 + | 2 c3_1_6570789 c3_1_8175806
#> 4 1 8175807-8401105 + | 2 c4_1_8175807 c4_1_8401105
#> loose.left loose.right node.id snode.id index
#> <logical> <logical> <integer> <numeric> <integer>
#> 1 TRUE FALSE 1 1 1
#> 2 FALSE FALSE 2 2 2
#> 3 FALSE FALSE 3 3 3
#> 4 FALSE FALSE 4 4 4
#> -------
#> seqinfo: 24 sequences from an unspecified genome
#> ... (600 additional nodes)
#>
#> gEdge object with 690 edges
#> sedge.id node1 chr1 pos1 node2 chr2 pos2 cn type n1.left
#> 1: 1 c1_1_6525379 1 6525379 c2_1_6525380 1 6525380 2 REF NA
#> 2: 2 c2_1_6570788 1 6570788 c3_1_6570789 1 6570789 2 REF NA
#> 3: 3 c3_1_8175806 1 8175806 c4_1_8175807 1 8175807 2 REF NA
#> 4: 4 c4_1_8401105 1 8401105 c5_1_8401106 1 8401106 2 REF NA
#> n1.right n2.left n2.right edge.id class n1.side n2.side n1 n2
#> 1: 1 2 NA 1 REF right left 1 2
#> 2: 2 3 NA 2 REF right left 2 3
#> 3: 3 4 NA 3 REF right left 3 4
#> 4: 4 5 NA 4 REF right left 4 5
#> ... (686 additional edges)
gG(remixt = myremixt)
#> gGraph with 6145 nodes, 94 loose ends (46 terminal and 48 internal), and 6203 edges (6122 REF and 81 ALT)
#> comprising:
#> gNode object of length 6145
#> GRanges object with 4 ranges and 37 metadata columns:
#> seqnames ranges strand | length major_is_allele_a
#> <Rle> <IRanges> <Rle> | <numeric> <integer>
#> 1 1 1-177417 + | 11278.414 1
#> 2 1 177418-267719 + | 2372.545 1
#> 3 1 267720-471368 + | 127.247 1
#> 4 1 471369-1000000 + | 262848.023 1
#> major_readcount minor_readcount readcount allele_ratio major_depth
#> <integer> <integer> <integer> <numeric> <numeric>
#> 1 38 2 18510 0.050000 1.559129
#> 2 0 0 5384 0.000000 2.269293
#> 3 0 0 2429 0.000000 19.088788
#> 4 18683 2598 82956 0.122081 0.277075
#> minor_depth total_depth major_0 minor_0 major_1 minor_1 major_2
#> <numeric> <numeric> <integer> <integer> <integer> <integer> <integer>
#> 1 0.0820594 1.641188 1 1 4 2 4
#> 2 0.0000000 2.269293 1 1 4 2 4
#> 3 0.0000000 19.088788 1 1 4 2 4
#> 4 0.0385292 0.315604 1 1 4 2 4
#> minor_2 major_raw minor_raw major_depth_e minor_depth_e total_depth_e
#> <integer> <numeric> <numeric> <numeric> <numeric> <numeric>
#> 1 2 66.8658 3.312029 0.0980487 0.0515662 0.149615
#> 2 2 97.4220 -0.218737 0.0980487 0.0515662 0.149615
#> 3 2 821.1136 -0.218737 0.0980487 0.0515662 0.149615
#> 4 2 11.7030 1.439058 0.0980487 0.0515662 0.149615
#> major_e minor_e total_e major_raw_e minor_raw_e major_diff
#> <numeric> <numeric> <numeric> <numeric> <numeric> <integer>
#> 1 1105.8340 581.58517 1687.4191 4 2 0
#> 2 232.6250 122.34318 354.9682 4 2 0
#> 3 12.4765 6.56167 19.0381 4 2 0
#> 4 25771.9109 13554.07911 39325.9900 4 2 0
#> minor_diff prob_is_outlier_total prob_is_outlier_allele
#> <integer> <numeric> <numeric>
#> 1 0 0.01 0.01
#> 2 0 0.01 0.01
#> 3 0 0.01 0.01
#> 4 0 0.01 0.01
#> total_likelihood_mask allele_likelihood_mask cn loose.left
#> <integer> <integer> <integer> <logical>
#> 1 0 0 6 TRUE
#> 2 0 0 6 FALSE
#> 3 0 0 6 FALSE
#> 4 0 0 6 FALSE
#> loose.right node.id snode.id index
#> <logical> <integer> <numeric> <integer>
#> 1 FALSE 1 1 1
#> 2 FALSE 2 2 2
#> 3 FALSE 3 3 3
#> 4 FALSE 4 4 4
#> -------
#> seqinfo: 23 sequences from an unspecified genome
#> ... (6141 additional nodes)
#>
#> gEdge object with 6203 edges
#> sedge.id type grl.ix prediction_id cn cn_0 cn_1 cn_2 n_1 side_1 n_2 side_2
#> 1: 1 ALT 1 2 1 0 1 1 318 1 197 0
#> 2: 2 ALT 2 3 1 0 1 1 409 0 456 1
#> 3: 3 ALT 3 4 1 0 1 1 430 1 432 0
#> 4: 4 ALT 4 5 1 0 1 1 591 0 592 1
#> edge.id class n1.side n2.side n1 n2
#> 1: 1 TRA-like right left 20 3253
#> 2: 2 DUP-like left right 111 158
#> 3: 3 DEL-like right left 132 134
#> 4: 4 DUP-like left right 293 294
#> ... (6199 additional edges)
## hard code a graph from GRanges and edges
nodes = c(GRanges("1",IRanges(1,100),"*"), GRanges("1",IRanges(101,200),"*"),
GRanges("1",IRanges(201,300),"*"), GRanges("1",IRanges(301,400),"*"),
GRanges("1",IRanges(401,500),"*"))
edges = data.table(n1 = c(3,2,4,1,3),
n2 = c(3,4,2,5,4),
n1.side = c(1,1,0,0,1),
n2.side = c(0,0,0,1,0))
gg = gG(nodes = nodes, edges = edges, meta = list(gr.colorfield = 'type'))
## mostly for developer use
gG(nodeObj = gg$nodes, edgeObj = gg$edges)
#> gGraph with 5 nodes, 3 loose ends (3 terminal and 0 internal), and 5 edges (1 REF and 4 ALT)
#> comprising:
#> gNode object of length 5
#> GRanges object with 4 ranges and 5 metadata columns:
#> seqnames ranges strand | loose.left loose.right node.id snode.id
#> <Rle> <IRanges> <Rle> | <logical> <logical> <integer> <numeric>
#> 1 1 1-100 + | FALSE TRUE 1 1
#> 2 1 101-200 + | FALSE FALSE 2 2
#> 3 1 201-300 + | FALSE FALSE 3 3
#> 4 1 301-400 + | FALSE TRUE 4 4
#> index
#> <integer>
#> 1 1
#> 2 2
#> 3 3
#> 4 4
#> -------
#> seqinfo: 1 sequence from an unspecified genome
#> ... (1 additional nodes)
#>
#> gEdge object with 5 edges
#> sedge.id type class edge.id n1.side n2.side n1 n2
#> 1: 1 ALT DUP-like 1 right left 3 3
#> 2: 2 ALT DEL-like 2 right left 2 4
#> 3: 3 ALT INV-like 3 left left 4 2
#> 4: 4 ALT DUP-like 4 left right 1 5
#> ... (1 additional edges)